This legendary pop girl is dubbed the "Songbird Supreme" and is behind the mega-hit songs "Vision of Love" and "We Belong Together"
Mariah Carey
This pop icon is Spotify top artist of 2023
Taylor Swift/ Taylor Alison Swift
This command allows you to move between directories.
cd
"Anong sinulat ni Enteng at Joey diyan" is a line from which Eheads song
Spoliarium
In centrifuges, what does RCF stand for?
Relative Centrifugal Force
Daisy Siete, a show that starred the Sexbomb Girls, premiered on GMA 7 in September 2003 and was on air until July 2010. How many seasons of Daisy Siete were there?
26
This Pinay icon is also known as "Mommy Oni". She is best known for her phenomenal track "MPL", a song about a state of mind after alcohol consumption.
Toni Fowler/Toni Fowler-Manalo
Which of the following is NOT a Linux distro: CentOS, Mint, SeveOS, Fedora
SeveOS
Piko
In AGE, what component of loading dye increases the density of DNA samples which allows them to sink when dispensed into wells
Glycerol
Katheryn Elizabeth Hudson is the real name of this global pop artist who popularized a song about the girls of a certain US state.
Katy Perry
How many unique colors are there in the Google icon?
4. Green, blue, red, yellow
In Linux, what does the command "pwd" stand for?
print working directory
"Connecting people" is the tagline of which Finnish multinational tech company known for its brick phones.
Nokia
Which industry supplier has exclusive distributorship of Vivantis products as of 2023?
This pop girl released a memoir this year titled "The Woman in Me", detailing her experiences as the biggest Pop act in the late 90's to early 2000's and the long legal battle against her father to remove her from conservatorship.
Britney Spears
Known to Tiktok users as "Ting Ting Tang Tang", what is the title of this song by Hoang Thuy Linh about a mermaid professing her love to a mortal?
See Tình
In Linux/Unix system, a ____ provides the user with a text-based interface wherein a user can enter command names, execute programs, and manipulate files.
shell
Who is Starstruck's very first Ultimate Male Survivor?
Mark Herras
Which restriction enzyme recognizes this sequence 5'-GGATCC-3'?
BamHI
In the hit song "Tala" by Sarah G., how many times did "Tala" appear in the lyrics?
44
This incumbent MSI faculty graduated with a PhD in Biology at the Dalhousie University, Canada.
Arturo Lluisma
This software engineer created the Linux OS
Linus Torvalds
also known as "School on Air", this children's educational television show aired on ABS-CBN from 1994 until 2004. It is produced, in part, by DepEd and DOST. Its iconic theme music was composed by National Artist Ryan Cayabyab.
Given the sequence:
atgcatatgttcacattcgaaccgtctctgctttgacatcgtgtggcgcttgggtgtaaagtcgtggccattaaacaaaattatttgtagaggctgtttcgtcctcacggactcatcagaccggaaagcacatccggtgacagctaactacgaaggggagtcagtatgaagcagcaggagaaggccaagaaggccta
Design an 18-nt reverse primer that will allow me to amplify this entire DNA region
FW: 5'-atgcatatgttcacattc-3'
RV: 5'-taggccttcttggccttc-3'