Classroom Expectations
True or false- you should never eat anything during a lab, UNLESS an adult teaching the lesson says you can after the lesson.
Which organelle is know as the “brain” of the cell?
Nucleus
Osmosis is the movement of what molecules?
a) air
b) water
c) sugar
b) water
What is a strand of genes called?
DNA
True or false- Mrs Schalow drinks coffee-
False
Who is responsible for completing make up work, test corrections, assignments, etc?
a) Miss Burke & Mrs Schalow
b) Family
c) Me, Myself, and I
I am the organelle that is considered the powerhouse of the cell.
What kind of transport are osmosis and diffusion?
Passive transport- they don’t require extra energy
Identify the inherited traits vs the acquired traits-
pierced ears naturally curly hair tattoos
short height attached ear lobes tanned skin
inherited- naturally curly hair, short, attached ear lobes
acquired- pierced ears, tattoos, tanned skin
What grade did Miss Burke teach before middle school?
4th Grade
When you enter the classroom, you should come in at a level _____, get out a ______ and ______, read the ________, and complete the _________ review if there is one.
1, pencil, paper, board, spiral
Which organelle has the job of collecting sunlight in the plant cell?
Chloroplasts
Photosynthesis and cellular respiration are two processes that create energy for the cell. What is the main product of photosynthesis and the main product of cell respiration?
Cell Respiration– ATP (energy)
Create the nitrogenous base that would pair up with the following sequence-
AGCTGCTTGCAGACTAATGC
TCGACGAACGTCTGATTACG
Which hobby does Miss Burke and Mrs Schalow have in common?
a) running
b) baking
c) reading
b) baking
Where can you find the study stacks links, back up copies of notes, and the slideshows Miss Burke and Mrs Schalow teach from?
Canvas modules
Explain the job of the cell membrane.
Regulates what enters the cell and what leaves the cell.
Which organelles do photosynthesis and cell respiration take place in?
Cell Respiration - mitochondria
Parent 1 has a genotype of Bb. Parent 2 has a genotype of bb. What is the chance the offspring will show the dominant trait? (show as a percentage)
50%
What is Miss Burke’s dog’s name?
Nellie
If you need anything while you’re in the classroom (bathroom, pencil, help, water, charger, headphones, throw away trash, etc), what do you have to do before leaving your seat?
Raise your hand and ask for permission
The endoplasmic reticulum can be smooth or it can be rough. What organelle attaches to the ER to make it rough?
Ribosomes
Meiosis and Mitosis are both cellular division processes. One process produces identical cells to replace damaged, sick, or old cells, and one process produces genetically diverse cells. Which is which?
Mitosis - identical cells
Meiosis - genetically diverse cells
During genetic reproduction, do cells complete mitosis or meiosis?
Meiosis
What is Miss Burke’s favorite ice cream flavor?
Mint chocolate chip OR cookies n cream