Whose blood matches that found at the scene?
Mike
Which of the following describes the place dead bodies are kept while they await an autopsy, identification, or burial?
a. Body Farm
b. Morgue
c. Autopsy
d. Funeral Home
b. Morgue
What does this image show?
Decomposition
Which of the following does NOT occur within the first 24 hours of death?
a. Livor mortis
b. Algor mortis (temperature change)
c. Rigor mortis
d. Decomposition
d. Decomposition
Name three criteria that are assessed during a toxicology test of a substance? Ex: texture
Color, texture, reaction to water, reaction to ferric nitrate, reaction to hydrochloric acid, pH
What is the approximate size of this restriction fragment?
130-140 bp
Classify each as the cause, mechanism, or manner of death.
Strangulation
Homicide
Asphyxiation
Strangulation - cause
Homicide - manner
Asphyxiation - mechanism
What does this image show?
Livor mortis
What is the difference between algor, rigor, and livor mortis?
Algor - change in temp. after death
Rigor - stiffening of body muscles
Livor - blood settles in the part of body near the ground
Identify if the following are examples of toxins or toxicants.
Gasoline
Posion Ivy
Botulism (produced by a bacteria)
Pesticides
Gasoline - toxicant
Posion Ivy - toxin
Botulism (produced by a bacteria) - toxin
Pesticides - toxicant
When DNA is traveling through an agarose gel, larger fragments will move _________ smaller fragments.
a. slower than
b. faster than
c. at the same rate as
Does this describe the cause, mechanism, or manner of death?
Mechanism (physiological change in the body that causes death).
What does this picture show?
Rigor mortis
Place these in order in relation to time of death (what happens first --> last).
Livor mortis, decomposition, algor mortis, rigor mortis
1. Algor mortis (change in temp)
2. Livor mortis
3. Rigor mortis
4. Decomposition
What is the difference between a toxin and a toxicant?
Toxins are naturally occurring poisons produced by living organisms.
Toxicants are poisons manufactured by humans.
Why are restriction enzymes needed before gel electrophoresis?
a. To make many copies of the DNA
b. To extract DNA from an individual
c. To cut the DNA into fragments
d. To glue DNA fragments together
c. To cut the DNA into fragments
What section of an autopsy report includes changes to the body seen after death?
a. External Examination
b. Internal Examination
c. Postmortem Changes
d. Toxicology Results
c. Postmortem Changes
What does this picture show?
Gel Electrophoresis chamber/process
An individual is found dead in their home. They were found at 12:30 pm, and their temperature was taken at 1 pm. The rectal temperature of the individual was 82 degrees F. Use the Glaister equation to determine time of death. Round to the nearest hour.
2 am (11 hours ago)
Toxicology is the "study of poisons." Typically, poisons such as drugs and alcohol, are ingested. Which body system would it be best to study if you were a toxicologist?
Digestive System
EcoRI cuts at the sequence below. How many fragments would be made if this DNA was cut?
G^AATTC
CTTAA^G
ATCGAATTCGGCTAGAATTCAT
TAGCTTAAGCCGATCTTAAGTA
3 Fragments
ATCG^AATTCGGCTAG^AATTCAT
TAGCTTAA^GCCGATCTTAA^GTA
Following an autopsy, the medical examiner noted that the cause of death was COPD, which affects the lungs and a person's ability to breathe. What body system does COPD affect?
Respiratory System
What do the scissors in this image represent?
Restriction enzymes
Why is time of death difficult to determine?
There are many factors to consider (state of the body, Glaister equation, etc.)
Ambient temperature can affect rate of cooling, making the Glaister equation not accurate.
The toxicology lab we performed on the pill in Anna's stomach was a ________ test because ________.
(presumptive or confirmatory)
Presumptive. We cannot be certain about the identity of the pill until a confirmatory test is performed.