Crime Scene
HBS - Functions
DNA
Autopsies
HIPAA
100

A person is found dead by a neighbor. What career would be involved in notifying the police and calling an ambulance?

What is a 911 Operator?

100

Protects and supports body organs; provides a framework the muscles can use to cause movement; stores minerals.

What is the skeletal system?

100

These three parts make up a nucleotide. 

What are a phosphate group, a sugar, and a nitrogen base?

100

An examination of a body after death that includes a dissection of vital organs to determine the cause of death.

What is an autopsy?

100
  • Was HIPAA violated?
  • A news reporter comes into the ER and tells the attending physician that there is suspicion that the accident in which the 25-year-old female was injured was caused by a sniper shooting on the freeway and he is doing a story for the nightly news. He wants the patient’s name and condition for his report.  The information is given after receiving consent from the patient.
  • No, since the patient gave consent HIPAA was not violated.
200

List three possible pieces of evidence that investigators could collect from a crime scene.

What are: 

Hair,

DNA,

Blood,

Shoe Print,

Finger Print

200
Responds to internal and external changes by activating and appropriate response; processes information. 

What is the nervous system?

200

AATTCCTTTACCGTTAAGGAAATGGC

How may times would the following restriction enzyme cut the DNA?

A/T

Twice

AA/TTCCTTTACCGTTAAGGAAA/TGGC

200

This medical professional that performs the autopsy.

Who is the medical examiner?

200
  • Was HIPAA violated?
  • A nurse and an orderly at a state hospital discussed the HIV/AIDS status of a patient and the patient’s spouse within earshot of other patients without making reasonable efforts to prevent the disclosure.
  • Yes, the nurse and orderly should not have been talking about their patient where the information could be overheard.
300

The diameter of a blood drop can be used to estimate this.

What is height from which the blood fell?

300

Assists with gas exchange with the external environment; keeps blood supplied with oxygen and removes carbon dioxide. 

What is the respiratory system?

300

According to Chargaff's rule, if you have 22% thymine bases, you would have this many guanine bases.

What is 28%?

300

List one thing a Medical Examiner may look for during the external examination.

Rigor Mortis

Lividity

Examine the clothes

Check under fingernails for evidence

Measure and weigh the body. 

300
  • Was HIPAA violated?
  • An 18-year-old high school senior gets pregnant.  She does not want to have the child and her best friend takes her to a doctor’s office for an abortion.  A few days later her mother reads a text about the abortion on her phone and angrily calls the doctor’s office, demanding more information.  The receptionist confirms that her daughter visited the office for an abortion.
  • Yes, although the student is still in high school, the student is no longer a minor and therefore her parents do not have access to her medical information unless specified by the student. 
400

Investigators can measure this from a victim to figure out the time of death, also called algor mortis.

What is body temperature?

400

Secretes hormones that regulate processes such as growth, reproduction and metabolism by body cells. 

What is the endocrine system?

400

The separation of nucleic acids or proteins, on the basis of their size, mass, and electrical charge, by measuring their rate of movement through and electrical field in a gel. 

What is gel electrophoresis?

400

The part of the body needs to be removed in order to perform the internal examination.

What is the chest plate/ribcage?

400
  • Was HIPAA violated?
  • A 19-year-old UCLA student is admitted through the ER for injuries sustained in a motor vehicle accident. He is in stable condition, but awake and alert. His father calls from Minnesota asking for information on his condition. The information is given after verifying that he is the patient’s father. 
  • Yes, consent was not given by the student to have his medical information shared with his father. 
500

Other than ridge pattern, scientists also have to use another pattern to identify and match fingerprints. These patterns are called this. 

What are minutiae?

500

Filters fluid in the body; mounts the attack against foreign substance in the body. 

What is the lymphatic and immune system?

500

Using the gel, determine what is the base pair length of the shortest fragment from sample C.

What is 100 base pairs?

500

The job of this medical professional is to study the effects of chemicals on the human body. 

Who is the toxicologist?

500

HIPAA stands for this.

What is the health insurance portability and accountability act?