Definitions
What is a restriction enzyme?
These are enzymes that act as 'molecular scissors' to cut DNA at a specific base sequence called a restriction site (Omand, 2025a).
Find the recognition site GGATCC in the DNA sequence below.
5' - GTAGGTAAGGATCCGGAGTCTAGTACGA - 3'
3' - CATCCATTCCTAGGCCTCAGATCATGCT - 5'
5' - GTAGGTAAGGATCCGGAGTCTAGTACGA - 3'
3' - CATCCATTCCTAGGCCTCAGATCATGCT - 5'
What are sticky ends?
A fragment of DNA in which the ends have a stretch of unpaired nucleotides, and the strands are not the same length (Sticky End, n.d.).
What's another name for restriction enzymes?
Restriction endonucleases (Omand, 2025a).
What kind of molecules are restriction enzymes?
Proteins
What is a recognition site?
A specific sequence of nucleotides within a DNA molecule that is recognized by a particular restriction enzyme, allowing the enzyme to split the DNA at that site (Restriction Enzymes, n.d.).
If the enzyme cuts at GAATTC, does it cut this: AGGAATTCCT?
Yes
What are blunt ends?
The end of a DNA duplex that has been cut by a restriction enzyme at the same site on both strands, so that there is no overhang (Blunt End, n.d.).
What does a restriction enzyme look for in DNA?
A specific pattern or site (Omand, 2025a).
Why do scientists cut DNA with restriction enzymes?
To cut DNA into smaller pieces so that they can be analyzed and manipulated more easily (Kratz, 2016).
What does "palindromic sequence" mean in DNA?
A sequence that is identical when read from both directions (Omand, 2025a).
If a DNA strand has two GAATTC sites, how many pieces will it become?
3
Are blunt ends or sticky ends better for joining pieces of DNA together?
Sticky ends (Omand, 2025a).
Can restriction enzymes be used more than once?
Yes (Enzymes Review, n.d.).
What do bacteria do when they are given a human gene like insulin?
They produce the human protein (How Did They Make Insulin from Recombinant DNA?, n.d.).
What is the role of DNA ligase?
It is an enzyme that acts as a molecular glue to rejoin fragments of DNA (Omand, 2025a).
What would happen if there's no cut site in a DNA strand?
The enzyme can't cut the DNA.
If two DNA pieces have matching sticky ends, what happens?
They can join together (Omand, 2025a).
True or False: One restriction enzyme can cut any DNA at any place
False: A particular restriction enzyme only cuts DNA at one specific DNA sequence (Cortez, n.d.).
What is the use of restriction enzymes in nature?
In nature, these enzymes protect bacteria against intruding DNA from other organisms and phages (Omand, 2025b).
What is the role of DNA Methylase?
They are enzymes that add a methyl group to one of the nucleotides at the restriction site to prevent restriction enzymes from cutting the DNA. It is used to protect gene fragments (Omand, 2025a).
The sequence GAATTC is the recognition site for a restriction enzyme. It cuts between the G and the A. If * is a methyl group, could you still cut this sequence?
5' - ATGCCGGAGTG*AATTCAGCAGT - 3'
3' - TACGGCCTCACTTAA*GTCGTCA - 5'
No
Can DNA ligase join two blunt ends?
Yes, but it's more difficult than if it were sticky ends (Omand, 2025a).
Why wouldn't a restriction enzyme work on mutated DNA?
The cutting site might be changed (Restriction Enzyme Key Considerations, n.d.).
Why do scientists often cut DNA and plasmids with the same restriction enzyme?
Different enzymes generate different overhangs. If the same enzyme is used for both, the same sticky ends are generated (Clark & McGehee, 2019).