Translation
Where does translation take place?
In the cytoplasm.
In the ribosome.
Where does transcription take place?
In the nucleus.
What is the structure of RNA?
Single stranded.
Where is DNA located?
In the nucleus.
Nucleus.
What other process that occurs in the nucleus is extremely similar to transcription?
DNA replication.
What is the protein assembled out of?
Amino acids.
What is taken out of mRNA after transcription?
Introns
What nitrogenous base is replaced with uracil?
Thymine
T
What is the structure of DNA?
A double helix.
double helix
What is the ectoplasmic reticulum used for?
Modifying proteins
What does a codon match with?
An anti-codon.
What direction is mRNA created?
5' to 3'.
What creates mRNA?
RNA Polymerase
What comprises a nucleotide?
A phosphate, sugar, and a base.
What is the difference between ribose and deoxyribose?
Ribose has an extra oxygen atom in the second position.
When attached to the ectoplasmic reticulum, where does the protein go?
Into the ECR.
If the non-template strand reads ACGATGCACTGCAACAGTCTATT, what will the RNA strand be?
ACGAUGCACUGCAACAGUCUAUU
How long does mRNA exist in a prokaryote, and how long in a eukaryote?
A few seconds, a few hours.
A few minutes, a few hours.
What is the shape of sugar on DNA?
Pentagonal
A pentagon
What is the speed of transcription compared to translation?
They are equal.
They are equivalent.
What does tRNA stand for?
Transfer RNA.
transfer RNA
If the template strand reads CGATTAGTAATGGATCTATACGTAGCTACA, then what is the RNA?
GCUAAUCAUUACCUAGAUAUGCAUCGAUCU
Where is RNA formed in a prokaryote?
The nuclear region.
Nuclear region.
What is the full name of DNA, spelled correctly?
Deoxyribose nucleic acid.
Which of the three cell types produces the shortest proteins?
Archael