PCR
population genetics
Genetics
Pandemic
?
100

What is PCR, and what is its purpose

Polymerase Chain reaction,

What is to amplify(make multiple copies of) target DNA in order to analyze and study. 

100

What is Microevolution 

Microevolution is a generation to generation change in a population’s allele frequencies (disruption to genetic equilibrium).

100

Who is the father of Genetics ?

Who is Gregor Mendel?
100

 What virus has spread across the globe, took hold in the United States,and has killed over 3.49 Million humans thus far.

What is the Corona Virus (Covid 19)

100

WHen Working with Hardy Weinberg equilibrum with 2 given alleles what are the two equations that are represented.

What are

         p + q = 1

       p2 + 2pq + q2 = 1

200

Which Cellular process does PCR represent? 

What is DNA Replication?

200

What are the causes of Microevolution?

What are 

1.Genetic Drift  2.Gene Flow 3.Mutation.      4.Selection

200

What are the three Laws of Inheritance 

What is the 


Law of Dominance 

Law of Segregation 

Law of Independent assortment

200

IN order, what are the essential parts of central dogma of Genetics, starting with in the genome.


    1 --2-->  3 ---4--> 5

what is 

   DNA ( Transcriptions )RNA(Translation) Protein

200
What month is Mr. Wilson's Birthday
February 
300

What are the ingredients found in PCR?

What is 

1.) Template DNA     2.) DNA polymerase

3.) Primers               4.) DNTPs

5.) Buffer

300

A city was intensively sprayed with KNJ in 1983 in an effort to control mosquitoes. The number of pests were immediately reduced to 1/3 its population size. Each year thereafter the city would spray KNJ, but the mosquitos gradually increased in numbers until 5 years later they were almost as abundant as they were when the control program began. Explain the phenomena   

What is the type of Genetic Drift that occured was BottleNeck effect.

300

A good example of complex heredity is blood type.  because there are more than 2 alleles that can be present.  which type of dominance does this represent and give an example.

 What is Codominance & AB blood type?

300

Six species of human coronaviruses are known, with one species subdivided into two different strains, making seven strains of human coronaviruses altogether. What causes of microevolution are pushing the spread of this virus.

What is the natural selection of the Mutated variants.

300

You have sampled a population in which you know that the percentage of the homozygous recessive genotype (aa) is 36%. Using that 36%, calculate the following:

A =     a=       AA =     Aa =.   aa= 

what is 

A = 40%.   a = 60%.   AA = 16%  Aa = 48% aa = 36%

400

In the following DNA fragment, what is the target DNA sequence? 

Forward Primer - GATTA -       

Reverse Primer -  AGGTC - 

Template DNA:   (5')TAGATTACTATGCGGACCTC (3')

                         (3')ATCTAATGATACGCCTGGAG (5')

What is 

TARGET DNA:    (5') CTATGCG (3')

                        (3')  GATACGC (5') 

400

In a population of 150 that is in Hardy-Weinberg equilibrium, 16% of the individuals are Dominant  homozygotes for a certain trait. For the same trait, what is the number of individuals in this population that are heterozygotes?  Show your Work

 What is 48% (72 individuals)

400

Color pattern in a species of duck is determined by one gene with three alleles. Alleles G and H are codominant, and allele i is recessive to both. How many phenotypes are possible in a flock of ducks that contains all the possible combinations of these three alleles? List them

 What are four G, H, GH, & ii

400

Given the following Viral RNA use the process of reverse transcription to determine the complementary and targeted DNA .

RNA  (5') AUG - UCA - GGG - GUG - UGA (3')

cDNA 

DNA

What is 

cDNA (3') TAC - AGT - CCC - CAC - ACT (5')

DNA   (5') ATG - TCA - GGG - GTG - TGA (3')

400

The ability to taste PTC is due to a single dominate allele "T". You sampled 215 individuals in biology, and determined that 150 could detect the bitter taste of PTC and 65 could not. Calculate all of the potential frequencies.     

T=        t =        TT =       Tt =    tt =

What is 

T = .55

t = .45

TT = .302

Tt  = .495

tt  = .2025