what is a predator
a trex
are earths days getting longer
yes Google said so
what is a gene
idku probably got it right.
what is a cell
a cell
is seb sigma????????
yes
what is a living thing that is not a plant
a animal.
does the body glow
yes it does Google said so
what are my genes
gtactcatcgtatcatcactaccatccgagctacgta
what is a cell
idk u probably got it right
daily double is seb sigma??
yes by a lot
what is a rough er
it has ribosomes.
who flew a plane
wright brothers
is maryem good at science
idk
how do you live
homeostasis
does Seb have rizz
yes he does
what is agene
a gene??
where is Albert from
germany
what genes do chica have
atatacctcaccgctacgcat
whatis chica
a lizard
wy is seb the best
he is kind
what is ecological succession.
when ecological sucedes better than the others.
what is e=mc2
some science thing
whaatis a gene
a genetic code thiingy
what is in a cell
idk u probablyknow
why is seb the best
because he is the best.