Potpurri
What part of the DNA sequence is responsible for giving specific traits?
What are Genes
Which cell organelle is considered the powerhouse of the cell?
What is the mitochondria?
What model did Watson and Crick say that DNA replication would occur in?
What is the semi-conservative model?
Transcription gives us what type of nucleic acid?
What is RNA?
What are the base pairing rules for translation?
What is A-U and G-C?
What macromolecule is responsible for building and repair, coordinating bodily functions, and maintaining homeostasis?
What are proteins.
Which cell organelle allows plant cells to go through photosynthesis?
What is the chloroplast?
DNA replication separates DNA into two strands, one strand is the leading strand the other is ___________?
What is the lagging strand?
What are the base pairing rules for transcription?
What is A-U and G-C?
Which organelle does translation occur in?
What is the ribosome?
What is a somatic cell? (and give an example.)
Body cell
Which cell organelle stores chromatin?
What is the nucleus?
What is the complimentary strand to ATCCAT?
What is TAGGTA?
Which organelle does transcription occur in the cell?
What is the nucleolus?
Which sequence of tRNA signals a start codon?
What is AUG?
Cross a heterozygous tall pea plant with a homozygous pea plant, (T, tall is dominant) with a heterozygous tall plant. What is the probability of a heterozygous tall offspring?
50%
Which process do vesicles perform that allows them to carry unwanted or harmful materials out of the cell?
What is the base pairing rules for DNA replication?
What mRNA strand would form from this strand of DNA?
AATCAT
What is UUAGUA?
What amino acids would this sequence code for?
AUG-UAA
Give an example of a phenotype.
Blue eyes
Brown hair
Purple flower
What process could a cell NOT do if we removed the ribosomes from a cell?
What is translation?
During which phase of the cell cycle does DNA Replication occur?
What is interphase?
What would be the template strand of DNA for this strand of mRNA?
AUGGUACAC
What is TACCATGTG?
What protein would be coded from this template strand of DNA?
ATACAACCCGGGTAGCATCTA
What is Met-Leu-Gly-Pro-Ser-Stop?